To compare the preoperative clinical and pathological characteristics of stage I non-small cell lung cancer （NSCLC） with spread through air spaces （STAS） using dual-energy CT （DECT）imaging parameters and construct a nomogram model for predicting STAS.
Methods
A total of 269 patients with pathologically confirmed stage I NSCLC from January 2016 to September 2024 were enrolled，including 100 STAS-positive and 169 STAS-negative cases. Clinical data，preoperative DECT imaging parameters，and pathological features were analyzed. LASSO-logistic regression was used to screen predictors and develop the nomogram. Model performance was evaluated via receiver operating characteristic （ROC） curve analysis （area under the curve，AUC），calibration plots，decision curve analysis （DCA），and clinical impact curve （CIC）.Propensity score matching （PSM，1∶1） adjusted for age，sex，smoking history，diabetes，hypertension，tumor location，and TNM stage yielded 86 STAS-positive and 86 STAS-negative cases for postoperative pathological analysis.
Results
Univariate analysis revealed significant differences in smoking history，emphysema，pleural retraction，spiculation，nodule type，consolidation-to-tumor ratio （CTR），RECIST diameter，small nodule volume，iodine ratio，and mean CT value between STAS-positive and-negative groups （P＜0.05）. Multivariate analysis identified emphysema background，spiculation，CTR，iodine ratio，and CT value as independent predictors of STAS. The nomogram model achieved an AUC of 0.800 （95%CI： 0.744 ～0.854），accuracy=75.1%，sensitivity=78%，specificity=73.4%，positive predictive value=63.4%，negative predictive value=84.9%，and F1-score=0.699. Calibration curves showed good agreement with ideal predictions，while DCA and CIC demonstrated clinical utility. Post-PSM analysis indicated that STAS correlated with aggressive pathological features，including vascular invasion （7.0% vs. 0.0%，P=0.029），intravascular tumor thrombus （11.6% vs.1.2%，P=0.013），elevated Ki-67 levels，and higher IASLC grading （P＜0.05）.
Conclusion
The clinical prediction model based on preoperative DECT parameters （emphysema background，spiculation，CTR，iodine ratio，and mean CT value） provides diagnostic value for preoperative STAS assessment in stage I NSCLC when combined with three-dimensional imaging features. STAS is associated with abundant blood flow and highly invasive pathological characteristics.
Dysfunction of type Ⅱalveolar epithelial cells （AT2） is considered one of the key pathological processes underlying the development of radiation-induced pulmonary fibrosis （RIPF）. miR-21 regulates epithelial to mesenchymal transition （EMT） during RIPF. However，the target gene through which miR-21 acts upon in the regulation of EMT remains to be confirmed. This study primarily investigates the molecular mechanisms and critical roles of miR-21 and CREBL2 in RIPF.
Methods
The chests of wild type（WT） mice and miR-21-/- mice were irradiated with 15Gy cobalt source γ-rays to establish a RIPF model.Through living lung function examination and lung hydroxyproline detection to evaluate the degree of pulmonary fibrosis in irradiated mice. Establishment of the rat type Ⅱalveolar epithelial cells line （RLE-6TN） irradiation model，the RT-qPCR and WB were used to detect the expression of endoplasmic reticulum stress （ERS） and EMT related markers in irradiated cells. Differentially expressed genes were identified through a microarray screen and validated using a dual-luciferase reporter assay.
Results
After irradiation，WT mice exhibited a 14-fold increase in miR-21 expression at 8 weeks post-irradiation. Additionally，hydroxyproline expression increased by more than 2-fold，while CREBL2 expression decreased by 50%. In contrast，miR-21-/- mice demonstrated an approximately 3-fold increase in CREBL2 expression following irradiation. The miR-21-/- mice exhibited a reduced degree of lung fibrosis compared to WT mice. The markers of ERS and EMT in the lung tissue of miR-21-/- mice were significantly reduced. Dual-luciferase reporter assays confirmed the specific binding of miR-21 to CREBL2.
Conclusion
Radiation-induced increase of miR-21 and decreased expression of its target gene CREBL2 in AT2 cells further activated the ERS signaling pathway，mediated EMT in AT2 cells，and finally led to the formation of RIPF.
To analyze the correlation between the variability of arterial partial pressure of carbon dioxide （PaCO2） and the prognostic risk in patients with acute respiratory distress syndrome （ARDS）during mechanical ventilation.
Methods
A total of 56 ARDS patients treated with mechanical ventilation in our hospital from January 2020 to August 2024 were selected as the study subjects. Twenty deceased cases were in the observation group and 36 survivors were in the control group. Demographic data，clinical outcomes，and laboratory indicators were collected. Changes in PaCO2 during mechanical ventilation were recorded，with 28-day all-cause mortality as the primary clinical outcome. Cox regression analysis was used to assess the correlation between PaCO2 variability and adverse prognosis.
Results
The observation group had，sequential organ failure assessment （SOFA） score of （9.92±2.45），acute physiology and chronic health evaluation Ⅱ（APACHE Ⅱ） score of （24.84±5.63），and PaO2/FiO2 of （191.38±22.89），which were significantly different from the control group，SOFA score（8.41±2.19），APACHE Ⅱscore（21.35±4.84），PaO2/FiO2（206.97±20.53）（P＜0.05）. No significant differences in PaCO2 levels were observed between the two groups during mechanical ventilation and at 1 day post-ventilation （P＞0.05）. However，the observation group showed higher PaCO2 levels at 2 days （40.09±1.77 ）mmHg and 3 days （44.21±1.53） mmHg post-ventilation compared to the control group （38.26±1.18）mmHg and （41.04±1.05 ）mmHg，respectively； P＜0.05）. PaCO2 variability decreased over time，with the observation group exhibiting higher variability than the control group（P＜0.05）. Cox regression analysis revealed that SOFA score （HR=1.197，95%CI：1.002～1.429） and PaCO2 variability （HR=1.315，95%CI： 1.141～1.514） were associated with adverse prognosis in ARDS （P＜0.05）.After adjusting for confounders，PaCO2 variability remained significantly correlated with adverse prognosis （HR=1.323，95%CI： 1.153 ～1.518； P＜0.05）.
Conclusion
Persistent elevation of PaCO2 during mechanical ventilation in ARDS patients is associated with increased mortality risk. Higher PaCO2 variability correlates with greater adverse prognosis risk. Monitoring PaCO2 variability may help reduce prognostic risk in ARDS.
To analyze the clinical efficacy of Nimotuzumab combined with Anlotinib and chemoradiotherapy in the treatment of advanced non-small cell lung cancer （NSCLC）.
Methods
A total of 73 NSCLC patients admitted to our hospital from January 2021 to December 2023 were selected and randomly divided into the control group 38 cases and the observation group 35 cases. The control group received Anlotinib+ chemoradiotherapy，while the observation group received additional Nimotuzumab on the basis of the control group. The short-term efficacy，tumor markers，immune function，adverse reactions，and prognosis were compared between the two groups.
Results
The disease control 31 cases （88.57%） in the observation group was higher than that in the control group 28 cases （73.62%） （P ＜0.05）. After treatment，the levels of cytokeratin 19 fragment （CYFRA21-1） （18.25±3.87） μg/L，carbohydrate antigen-125 （CA125） （42.12±5.87） U/ml，and carcinoembryonic antigen （CEA） （25.44±4.16 ）ng/ml in the observation group were lower than those in the control group CYFRA21-1 （25.62±4.12） μg/L，CA125（59.21±6.48）U/ml，CEA（37.59±5.01）ng/ml （P＜0.05）. Post-treatment immune function indices in the observation group，including CD4+（29.77±3.41）%，CD8+（29.46±3.12）%，and CD4+/CD8+ ratio （1.14±0.21） were higher than those in the control group CD4+（25.44±2.87）%，CD8+（25.77±2.55）%，CD4+/CD8+（0.92±0.15） （P＜0.05）. Adverse reactions occurred in the observation group 15 cases （42.86%） and 11 cases （28.95%） in the control group（P＞0.05）. The six-month survival rate in the observation group 34 cases （97.14%） was higher than that in the control group 30 cases（78.95%） （P ＜0.05）.
Conclusion
Nimotuzumab combined with Anlotinib and chemoradiotherapy for advanced NSCLC patients improves short-term efficacy，reduces tumor marker levels，mitigates chemotherapy-induced adverse effects on immune function，enhances survival rates，and demonstrates good safety.
To investigate the relationship between serum melanoma antigen A3（MAGEA3） and the diagnosis and prognosis of resectable lung adenocarcinoma.
Methods
All of 119 patients with resectable lung adenocarcinoma admitted to our hospital from March 2019 to April 2023 were selected as the observation group，and 55 patients with benign lung disease were selected as the control group. The expression level of serum MAGEA mRNA was detected by real-time quantitative polymerase chain reaction（rtPCR）. Serum MAGEA3 and MAGEA4 levels were detected by enzyme-linked immunosorbent assay. The diagnostic value of serum MAGEA3 was determined by receiver operator characteristic （ROC） curve. Follow-up up to December 2024，recurrence-free survival time was recorded.
Results
Serum MAGEA3 mRNA （2.03±0.45） and MAGEA4 mRNA （1.49±0.25） in the observation group were higher than those in the control group（1.01±0.21），（0.98±0.16）.There was significant difference （P＜0.05）. There was no significant difference in MAGEA1 mRNA，MAGEA2 mRNA and MAGEA6 mRNA between the two groups （P＞0.05）. Serum MAGEA3 level in the observation group was 48.33 （40.25，60.89） pg/ml and 34.20 （22.35，44.25） pg/ml in the control group （P＜0.05）. Multivariate Logistic regression analysis showed that serum MAGEA3 was a risk factor for lung adenocarcinoma （OR=2.112，95%CI： 1.552～2.873，P＜0.05）. ROC curve analysis showed that the area under the curve （AUC） of serum MAGEA3 for diagnosis of lung adenocarcinoma was 0.762，which was higher than the AUC 0.623 for carcinoembryonic antigen（CEA） and the AUC 0.613 for cytokeratin fragment 19 antigen 21-1（CYFRA211）. The AUC of the diagnosis of MAGEA3+CEA+neuron-specific enolase（NSE）+CYFRA211 was 0.865，the sensitivity and specificity were 84.87% and 76.36%，respectively. The high expression of MAGEA3 （≥37.71 pg/ml） was ≥60 years old，and the proportion of clinical stage T2-4 and TNM stage Ⅱ～Ⅲwas higher （P＜0.05）. The median follow-up period was 24.30 months （0.5-58.30 months），57 cases （47.90%） recurred，including 39 cases of local/regional recurrence and 18 cases of distant metastasis. The median serum MAGEA3 level of 55.97 pg/ml in relapsed patients was higher than 42.29 pg/ml in non-relapsed patients （Z=-4.423，P=0.000）. Kaplan-Meier curve analysis showed that the median survival time of relapse-free patients with serum MAGEA3≤48.33 pg/ml was 44.10 months，which was higher than that of patients with serum MAGEA3＞48.33 pg/ml 28.30 months （P=0.006）. The recurrence rate was 25.00%（15/60） in patients with serum MAGEA3 ≤48.33 pg/ml，and 71.19% （42/59） in patients with serum MAGEA3＞48.33 pg/ml.
Conclusion
Serum MAGEA3 level combined with traditional serum tumor markers can improve the diagnostic efficiency of lung adenocarcinoma patients，and its high level is associated with poor prognosis of patients.
To investigate the expression level of serum miR-146a in patients with sepsis complicated with acute lung injury （ALI） and its correlation with prognosis.
Methods
Sixty-nine patients with sepsis complicated with ALI admitted to Tongchuan People′s Hospital from January 2021 to December 2024 were selected. According to the survival status of the patients，they were divided into the control group 45 cases and the observation group 24 cases. The clinical data of the two groups of patients were compared，and univariate analysis was conducted. The factors with statistical significance were subjected to multivariate Logistic regression analysis. The correlation between the expression level of miR-146a and the Acute Physiology and Chronic Health Evaluation Ⅱ（APACHE Ⅱ） score was analyzed，and a receiver operating characteristic curve（ROC） was constructed to predict the performance of serum miR-146a in diagnosing the prognosis of patients with sepsis complicated with ALI.
Results
The observation group exhibited significantly higher APACHE Ⅱscores （28.74±11.59 vs. 19.38±9.46，P ＜0.05），Sequential Organ Failure Assessment （SOFA） scores（14.06±4.67 vs. 9.25±3.40，P＜0.05），Lung Injury Scores （LIS） （2.45±0.51 vs. 2.09±0.35，P＜0.05），C-reactive protein （CRP） levels （37.24±6.35 μg/ml vs. 26.67±4.51 μg/ml，P ＜0.05），and miR-146a expression levels （2.68±1.39 vs. 1.44±0.81，P＜0.05） compared to the control group. The incidence of septic shock was significantly higher in the observation group 24 cases （77.42%） than in the control group 11 cases（20.00%） ，P ＜0.05. Spearman correlation analysis revealed a positive association between miR-146a expression and APACHE Ⅱscores （r=0.259，P=0.016）. Multivariate logistic regression identified septic shock，higher APACHE Ⅱscores，SOFA scores，LIS scores，CRP levels，and elevated miR-146a expression as independent risk factors for poor prognosis （P＜0.05）. The area under the ROC curve （AUC） for serum miR-146a in predicting poor prognosis was 0.789 （95%CI： 0.681 ～0.897），with a sensitivity of 61.3% and specificity of 89.1%，indicating strong predictive value.
Conclusion
The expression of serum miR-146a in sepsis complicated with ALI is closely related to the prognosis of patients，and it can be used as a potential biomarker for judging the severity of the disease and predicting the prognosis.
To analyze the predictive value of clinical features and computed tomography（CT） texture features in the invasiveness of pulmonary glass nodule.
Methods
A total of 93 patients with ground glass nodules detected by chest CT in our hospital from July 2021 to September 2024 were selected as subjects. 65 patients （69.89%） were randomly selected as the training set and 28 patients （30.11%） as the verification set. According to postoperative pathology，patients with non-invasive adenocarcinoma and invasive adenocarcinoma were divided into two groups. Clinical features and CT texture features were collected，and the difference in parameters between the two groups was compared. Factors predicting the invasiveness of pulmonary ground glass nodules were screened by Logistic regression analysis，and a prediction model was built. The predictive value of the model was analyzed by receiver operating characteristic curve （ROC） and verified by empirical set.
Results
In the training set，nodule shape （χ2 =4.317，P＜0.05），air bronchial sign （χ2 =6.717，P ＜0.05），internal vascular sign （χ2 = 11. 405，P ＜0. 05） of 27 patients with non-invasive adenocarcinoma and 38 patients with invasive adenocarcinoma were analyzed. Lobus （χ2=4.636，P＜0.05），diameter （t=4.341，P＜0.05），volume （t=6.713，P＜0.05），average CT value （t=2.936，P＜0.05），consolidation rate （t=8.371，P＜0.05），CT eigenvalue contrast （t=4.144，P＜0.05），correlation （t=4.031，P＜0.05），entropy （t= 4.797，P ＜0.05） and energy （t= 2.651，P ＜0.05） were statistically significant.Multivariate Logistic regression analysis showed that nodule volume （OR=1.371，95%CI： 1.005 ～1.869），average CT value （OR=1.032，95%CI： 1.002 ～1.062），consolidation rate （OR=2.433，95%CI： 1.256 ～4.712），CT eigenvalue contrast （OR=4.177，95%CI： 1.554～11.226），entropy （OR=1.798，95%CI： 1.035～3.123） and energy （OR=3.071，95%CI： 1.033～9.133） were the risk factors affecting the invasiveness of pulmonary glass nodule （P ＜0.05）. The result of Hosmer-Lemeshow test based on clinical and CT texture features was 12.069，P=0.148. ROC curve showed that the area under curve （AUC） of the combined model in the training set and validation set were 0.967 and 0.959 respectively，with sensitivity 92.62% and 83.33%，specificity 96.55% and 97.56%，and accuracy 91.39% and 88.76%. It was higher than the predicted value of clinical features and CT texture features.
Conclusion
Clinical features and CT texture features have high accuracy in predicting the invasiveness of pulmonary ground glass nodules，and their combined prediction improves accuracy and reliability，providing support for early invasive judgment and individualized treatment.
To analyze the expression level of programmed death ligand 1 （PD-L1） in nonsmall cell lung cancer （NSCLC） patients before and after surgical treatment.
Methods
Sixty-seven NSCLC patients treated at our hospital from May 2019 to May 2024 were selected. PD-L1 expression levels in preoperative，intraoperative，and postoperative recurrence samples were detected，and tumor proportion scores（TPS） were interpreted. Disease stage，histological type，treatment modalities，and recurrence type were compared between patients with or without changes in PD-L1 expression postoperatively and at recurrence. A line chart was plotted to observe longitudinal changes in PD-L1 expression levels in NSCLC patients.
Results
Among the 67 patients，the median follow-up time was 24 （6，48） months. By the last follow-up，29 survivors，38 patients （56.72%） died，with causes including intracranial hypertension or brain herniation 16 cases（42.11%），pathological fractures or spinal cord compression 6 cases （15.79%），respiratory failure 3 cases（7.89%），local tumor progression 4 cases （10.53%），and distant metastasis 9 cases （23.68%）. Postoperative changes in PD-L1 expression occurred in 21 patients （31.34%），including 9 cases （13.43%） with increased PD-L1 expression and 12 cases （17.91%） with decreased PD-L1 expression，while 46 patients （68.66%）showed no change. At recurrence，PD-L1 expression changed in 25 patients （37.31%），with a median time from surgery to recurrence of 14.6 （8.5，20.6） months. Among these，11 cases （16.42%） had increased PDL1 expression and 14 cases （20.90%） had decreased expression，while 42 patients （62.69%） showed no change，with a median time from surgery to recurrence of 14.0 （9.5，22.4） months. Among 35 cases of distant recurrence，23 cases （65.71%） had solitary brain metastases，8 cases （22.86%） had multiple bone metastases，and 4 cases （11.43%） had concurrent pleural metastases. Among 21 local recurrence cases，14 cases （66.67%） showed ipsilateral pleural dissemination，and 7 cases （33.33%） presented with hilar/mediastinal lymphadenopathy. The change in PD-L1 score category was significantly higher in distant recurrence cases （48.57%） compared to local recurrence cases （23.81%） （P＜0.05）. Thirty-eight patients （56.72%）experienced at least one change in PD-L1 score category，13 cases （19.40%） had two changes，and 6 cases（8.96%） exhibited three categories.
Conclusion
The expression level of PD-L1 in tissue samples from NSCLC patients undergoing surgical resection exhibits dynamic changes throughout the disease course.
To investigate the relationship between the characteristics of chronic obstructive pulmonary disease （COPD） and the obstructive pulmonary disease with transthoracic ultrasonography.
Methods
All fo 57 patients with stable COPD who were admitted to our hospital from June 2021 to June 2023 were selected to examine lung function by ultrasound elastography. According to the disease condition，21 cases of severe patients were divided into observation group and 36 cases of mild and moderate patients were divided into control group. The clinical data，lung function and transthoracic ultrasound elastography were compared between the two groups. Multivariate Logistic regression was used to analyze the correlation between the characteristics of transthoracic elastography and the severity of COPD.
Results：
There was no significant difference in age，blood sugar and other clinical data between the two groups （P＞0.05）. Intercostal muscle thickness index（ICMTei）（0.33±0.07） cm and intercostal muscle shear wave elastography（ICMswe）（0.35±0.08） cm in the observation group were lower than those in the control group ICMTei （0.42±0.10） cm （t=2.262，P=0.028），ICMswe（0.46±0.11） cm （t=2.649，P=0.011），diaphragmatic thickness at the end of inspiration（DTei） （27.71±4.13） kPa and diaphragmshear wave elastography（ Dswe） （24.78±3.61） kPa in observation group were higher than DTei （22.19±3.58） kPa （t=3.553，P=0.001），Dswe （17.42±2.83）kPa （t=4.738，P=0.000）in control group. FEV1（1.13±0.12） L，FVC （1.65±0.26） L，FEV1/FVC （48.26±2.81）% in the observation group were lower than those in the control group FEV1（1.42±0.15）L （t=7.340，P=0.000），FVC（1.85±0.31）L （t=4.689，P=0.000），FEV1/FVC （（58.35±3.23）% （t=11.916，P=0.000）. Multivariate Logistic regression analysis showed that ICMTei （OR=4.63×10-8） and ICMswe （OR=2.03×10-4） were protective factors for the severity of COPD. DTei （OR=1.437） and Dswe （OR=1.448） were risk factors for COPD severity. FEV1，FVC and FEV1/FVC were positively correlated with IICMTei and ICMswe （P＜0.05），and negatively correlated with DTei and Dswe （P ＜0.05）.
Conclusion
The characteristics of transthoracic elastography are correlated with the severity of COPD. DTei and Dswe are risk factors，ICMTei and ICMswe are protective factors.
To analyze the expression and clinical significance of human microRNA-195-5p（hsa-miR-195-5p） in serum exosomes of patients with non-small cell lung cancer （NSCLC）.
Methods
All of 107 patients with NSCLC admitted to our hospital from January 2021 to December 2024 were selected as the observation group，and 50 patients with benign lung disease confirmed by pathological examination during the same period were selected as the control group. Exosomes were characterized by nanoparticle tracking analysis（NTA），transmission electron microscope （TEM） and Western blot. real-time fluorescent quantitative polymerase chain reaction （rtPCR） was used to detect hsa-miR-195-5p in serum exosomes of the two groups，and the diagnostic value of hsa-miR-195-5p in NSCLC was analyzed. The levels of hsa-miR-195-5p in NSCLC patients with different pathological features were compared.
Results
TEM showed that the classical complete membrane structure of extracellular vesicles was about 100 nm in diameter. NTA analysis showed that the diameter of the isolated vesicles in serum was （77.20±16.15） nm. Western blot analysis revealed the expression of CD9，CD63，TSG101 and Annexin V in the samples. The level of serum exosome hsa-miR-195-5p in the observation group was 0.28 （0.15，0.65） lower than that in the control group 1.13 （0.44，2.05） （P=0.000）.The area under curve （AUC） （95%CI） of serum exosome hsa-miR-195-5p for diagnosis of NSCLC was 0.824（0.752 ～0.895），the sensitivity was 0.766，and the specificity was 0.780. hsa-miR-195-5p combined carbohydrate antigen-125 （CA125），carcino-embryonic antigen，CEA），neuronspecific enolase （NSE），and human epididymal protein 4 （HE-4） in diagnosis of NSCLC had an AUC of 0.895 （Z=-3.099，P=0.001）.Low expression level of serum exosome hsa-miR-195-5p （＜0.28） was associated with higher disease stage （P=0.015）.
Conclusion
The decreased expression level of serum exosome hsa-miR-195-5p in patients with NSCLC has clinical significance in the differential diagnosis of benign and malignant pulmonary diseases，and it is helpful for the diagnosis of NSCLC and screening of high-risk groups.
To analyze the significance of circulating tumor DNA （ctDNA） in predicting the risk of recurrence after adjuvant chemotherapy in resectable non-small cell lung cancer （NSCLC）.
Methods
A total of 40 patients with NSCLC who underwent radical surgical resection and received adjuvant chemotherapy were selected from our hospital from January 2020 to May 2023. Blood samples were collected and ctDNA analysis was performed on tumor tissue and plasma samples by macrogene second generation sequencing.Relapse-free survival （RFS） was recorded，and the correlation between ctDNA and relapse after adjuvant chemotherapy was analyzed.
Results
At least 1 gene mutation was found in 40 cases，TP53 mutation was found in 27 cases （67.50%）. ctDNA was positive in 30 patients （75.0%） and TP53 gene mutation rate was 66.67% （20/30）. There were 8 ctDNA positive cases and 32 ctDNA negative cases. Positive ctDNA was associated with pathological TNM stage （P=0.047），and the positive rate of ctDNA in stage ⅠB/Ⅱand Ⅲpatients was 10.71% （3/28） and 41.67% （5/12），respectively. COX regression analysis showed that positive ctDNA after surgery （OR=4.028，P=0.048） and positive ctDNA after adjuvant chemotherapy （OR=5.049，P=0.036） were risk factors for recurrence of resectable NSCLC after adjuvant chemotherapy. In the 40 cases，10 cases（25.00%） relapsed，including 6 cases in mediastinal lymph nodes，1 cases in lung，2 cases in neck，1 cases in chest，7 cases in pemetrexed + carboplatin，3 cases in paclitaxel + carboplatin. During the follow-up period，39 patients survived，and 1 patient died after 5 months recurrence due to new signs of the right pulmonary hilum with bone metastasis. Of the 8 cTDNA-positive patients，4 caseshad N2 stage，of which 3 cases had mediastinal lymph node recurrence. K-M curve analysis showed that the recurrence rate of cTDNA-positive patients was 50.0% （4/8） higher than that of cTDNA-negative patients 18.75% （6/32）. The median RFS were 103 d and 283 d，respectively （log rank χ2 =4.576，P=0.032）. ctDNA was positive in 9 cases（22.50%） after adjuvant chemotherapy，including pemetrexed + carboplatin in 7 cases and paclitaxel +carboplatin in 2 cases. K-M curve analysis showed that compared with 12.90% （4/31） of ctDNA-negative patients after adjuvant chemotherapy，ctDNA-positive patients had a higher recurrence rate 66.67% （6/9） and a shorter median RFS （287 d vs. 135 d） （log rank χ2=13.049，P＜0.001）. The recurrence rate of 26 cases with negative ctDNA after surgery and adjuvant chemotherapy was 11.54%. The recurrence rate of 3 patients with ctDNA positive after surgery and adjuvant chemotherapy was 100.0%. After adjuvant chemotherapy，the recurrence rate of ctDNA negative to positive was 50.00% in 6 cases and 20.00% in 5 cases.
Conclusion
Positive ctDNA after surgery and adjuvant chemotherapy is associated with a higher risk of postoperative recurrence in patients with NSCLC. ctDNA can be used as a prognostic marker of postoperative adjuvant chemotherapy in NSCLC.
To investigate the roles of circular ubiquitin-associated protein 2-like（circUBAP2L），hsa-let-7c，and its target gene glutamate decarboxylase 1 （GAD1） in lung adenocarcinoma.
Methods
Small-RNA sequencing was used to identify differential expression of hsa-let-7c. Bioinformatics analysis and real-time polymerase chain reaction （PCR） were used to assess differential expression of circUBAP2L （the upstream gene of hsa-let-7c） and GAD1 （the downstream target gene）. Dual-luciferase reporter assays were conducted to validate the regulatory relationships between circUBAP2L and hsa-let-7c，as well as hsa-let-7c and GAD1. A lentivirus was used to construct a GAD1 overexpression model in A549 lung cancer cells. Transcriptomic RNA sequencing （RNA-seq） and metabolomic liquid chromatography-mass spectrometry （LC-MS） were performed to analyze GAD1-associated differential genes and metabolites. Multiomics integration was applied to explore the impact of GAD1 on amino acid metabolism in lung adenocarcinoma cells.
Results
Real-time PCR confirmed upregulated expression of circUBAP2L in lung adenocarcinoma （P＜0.01）. Analysis of TCGA and GTEx databases revealed reduced expression of hsa-let-7c in lung adenocarcinoma tissues （P ＜0.0001），which was further validated by small-RNA sequencing （P ＜0.01）.Transcriptomic sequencing showed elevated GAD1 expression in lung adenocarcinoma compared to normal tissues （ P = 0. 032 ）. Dual-luciferase reporter assays identified a binding site （ CTACCTCCGACAACCTATACCT） between circUBAP2L and hsa-let-7c，while LC-MS metabolomics revealed that the GAD1 gene locus （AACAUGU） on the hsa-let-7c promoter binds to GAD1. Transcriptomic and metabolomic analyses demonstrated that GAD1 overexpression in lung adenocarcinoma cells increased levels of 1-methylhistidine （log2FC=2.37，P=0.00023），L-erythro-4-hydroxyglutamate （log2FC=2.02，P=0.00055），and dimethylglycine （log2FC = 2.45，P = 0.00129），affecting glycine，serine，and threonine metabolism pathways （P=0.00059） and cancer-related pathways （P=0.00541）.
Conclusion
circUBAP2L regulates 1-methylhistidine and dimethylglycine metabolism in lung adenocarcinoma cells through the hsa-let-7c/GAD1 axis.
To analyze the in vitro bacteriostatic effect and clinical significance of plasma activated saline （PAS） on Mycobacterium tuberculosis.
Methods
One standard strain of Mycobacterium tuberculosis and five clinically isolated mycobacterium tuberculosis （No. 6180，6943，7158，6545，7154）were selected for growth experiments. Mycobacterium tuberculosis was treated with normal saline （NS group），plasma activated saline （PAS group） and hydrochloric acid （HCl group）. The colony morphology of Mycobacterium tuberculosis in each group was observed after 31 days of culture，and the number of bacteria was counted after 14，20，26 and 31 days of culture. The growth curve was drawn，and Kruskal-Wallis test was used to compare the differences in colony growth between groups.
Results
Colony morphology of Mycobacterium tuberculosis was observed. After 14 days of culture，except 6180 strains，the other 5 strains had colony growth in NS group，with 50 ～100 colonies. After 20 days of Mycobacterium tuberculosis culture，6 strains in HCl group grew. After 26 days of Mycobacterium tuberculosis culture，except PAS group of 6545 strain，the other 5 strains grew. After 31 days of Mycobacterium tuberculosis culture，the size，shape and distribution of the 6 strains in NS group and HCl group were basically the same，while the distribution of the 6 strains in PAS group was less. The growth curves of 6 strains of Mycobacterium tuberculosis treated with normal saline，PAS and HCl showed that the growth trend of PAS group was lower than that of NS group and HCl group. Compared with the difference of Mycobacterium tuberculosis colony growth under normal saline，PAS and HCl treatment，the colony count of Mycobacterium tuberculosis in NS group was higher than that in PAS group （P＜0.05），and there was no statistical significance in the growth of Mycobacterium tuberculosis between NS group and HCl group （P＞0.05）.
Conclusion
Plasma activated saline has inhibitory effect on Mycobacterium tuberculosis in vitro experiment，showing great potential in anti-tuberculosis treatment，and may play a synergistic role in combined treatment to improve the therapeutic effect.
To analyze the efficacy and safety of Bevacizumab injection （Avastin）combined with standardized chemotherapy in elderly patients with non-small cell lung cancer （NSCLC）.
Methods
A total of 74 elderly NSCLC patients admitted to our hospital from January 2017 to December 2022 were enrolled，divided into two groups based on treatment methods： 34 patients received a combination of paclitaxel and cisplatin chemotherapy （TP） as the control group，and 40 patients received a combination of TP and bevacizumab as the observation group. The treatment course lasted six cycles （18 weeks）. Clinical efficacy，tumor marker levels，immune function，overall survival rate （OS），progression-free survival （progression-free survival，PFS），and treatment-related adverse events （AE） were analyzed between the two groups.
Results
The total effective rate in the observation group was 31 cases（77.50%），while that in the control group was 20 cases（58.82%）. The total effective rate of the observation group was higher than that of the control group there was no significant difference between two groups. After treatment，the carcinoembryonic antigen（carcinoembryonic antigen，CEA） level in the observation group decreased to 16. 75 ± 2. 45） ng/ml，carbohydrate antigen 125 （carbohydrate antigen 125，CA125） （35.97±4.46） ng/ml，cytokeratin 19 fragment（cytokeratin，CY211） （15.45±2.43） U/ml； lower than the control group CEA （20.93±3.16） ng/ml，CA125（50.11±6.58） ng/ml，CY211 （20.35±3.26） U/ml； in the observation group after treatment，immune function CD3+（49.16±4.32），CD4+（30.31±3.41），CD8+（32.56±4.30），natural killer cells （NK） （21.02±3.06）were better than the control group （45.40±4.12），（26.68±3.02），（35.79±4.69），（17.69±2.21） （P＜0.05）.During the follow-up period of the observation group，11 cases died，and an average OS of 20.34 months（18.70，21.96）； 16 deaths in the control group，average OS 15.03 months （12.83，17.37），the difference between the two groups was statistically significant （χ2=4.992，P=0.025）. The adverse drug reaction rate in the observation group was 20.00%，in the control group was 23.53%，with no statistical significance （P ＞0.05）.
Conclusion
Bevacizumab injection （Avastin） combined with standardized chemotherapy can improve clinical efficacy in elderly NSCLC patients，extend progression-free survival and overall survival，without increasing the incidence of adverse reactions，demonstrating good clinical efficacy and safety in the treatment of elderly NSCLC.
To analyze the clinical characteristics of patients with severe pneumonia infected by melioidosis and explore the related factors affecting the prognosis of patients.
Methods
From January 2020 to April 2024，49 patients with severe pneumonia infected by pseudomalleolus in the Second Naval Hospital of the Southern Theater Command，Sanya Central Hospital and Hainan Branch of the PLA General Hospital were selected as the research objects，and their general information，clinical symptoms，imaging manifestations and laboratory examination results were collected. According to the survival situation of patients with severe pneumonia infected by Bacteroides mallei one month after admission，28 survivors were the control group，and 21 deaths were the observation group. The clinical data of the two groups were compared，and the risk factors affecting the prognosis of patients with severe pneumonia infected by Bacteroides mallei were analyzed by multivariate Logistic regression.
Results
In the observation group，white blood cell count was（10.40±2.48） ×109/L，lymphocyte count was （1.04±0.16）×109/L，interleukin-6 was （64.75±9.20） ng/L and procalcitonin was （1.04±0.16） ng/L. The partial pressure of oxygen （PaO2） was （47.18±6.94） mmHg，the partial pressure of carbon dioxide （PaCO2） was （44.36±7.48） mmHg，the potassium level was （5.37±0.83）mmol/L. The proportion of patchy consolidation in main pathological types was 13 cases （61.90%） and the proportion of involvement of other organs or tissues was 12 cases（57.14%）. Compared with the observation group，in the control group，the age was （59.15±7.18） years，the white blood cell count was （8.71±2.39）×109/L，the lymphocyte count was （1.16±0.20）×109/L，the interleukin-6 level was （58.06±9.35） ng/L，and the procalcitonin level was （28.51±8.46） ng/L （assuming values were missing for procalcitonin range）. PaO2 was （51.37±7.15） mmHg，PaCO2 was （40.15±6.09） mmHg，the potassium level was （4.62±0.78） mmol/L.The proportion of patchy consolidation in main pathological types was 12 cases（41.38%） and the proportion of involvement of other organs or tissues was 8 cases （27.59%） （P ＜0.05）. Multivariate Logistic regression analysis showed that White blood cell count （OR=1.398，95%CI： 1.017～1.922），lymphocyte count （OR=0.607，95%CI： 0.426～0.864），creatinine （OR=1.548，95%CI：1.117 ～2.145），PaCO2（OR=1.132，95%CI： 1.030～1.245） and large patular degeneration （OR=1.183，95%CI：1.020～1.372） were independent risk factors for the prognosis of patients with severe pneumonia infected with melioidosis （P＜0.05）.
Conclusion
White blood cell count，creatinine，PaCO2，changes in lymphocyte count，large consolidation，pulmonary infiltration，nodules or cavities，and large plaque consolidation prognostic risk factors in patients with severe pneumonia infected by melioidosis.
To analyze the application effect of a multimodal respiratory training device combined with comprehensive pulmonary rehabilitation training （PRT） management during the perioperative period of thoracoscopic surgery for lung cancer.
Methods
Seventy-two patients undergoing thoracoscopic lobectomy for lung cancer in our hospital from February 2023 to October 2023 were selected and randomly divided into a control group （37 cases） and an observation group （35 cases）. The control group received conventional interventions perioperative care for lung cancer，while the observation group received comprehensive PRT management and a multimodal respiratory training device in addition to the conventional interventions. Lung function indicators （FEV1，FVC，PEF，SpO2），quality of life scores （QLICP-LU，GSES），and postoperative complications were compared between the two groups at preoperative day 1，postoperative day 5，and postoperative one month to evaluate the intervention efficacy.
Results
On preoperative day 1，the observation group showed higher FEV1（57.83±3.85%），FVC （2.26±0.35）L，PEF（4.20±0.27）L/m，and SpO2（93.34±3.06%） compared to the control group （P＜0.05）. By postoperative day 28，the observation group demonstrated significantly higher FEV1（69.54±7.13）%，FVC（2.83±0.48）L，PEF（4.48±0.39）L/m，and SpO2（95.49±3.08）% than the control group （P＜0.01）. On postoperative day 5，the observation group had higher QLICP-LU scores （160.40±14.04） and GSES scores （34.34±2.88） compared to the control group （149.22±20.84），（31.91±4.81）（P＜0.05）. By postoperative day 28，the observation group maintained higher QLICP-LU （178.80±13.17） and GSES scores （35.80±3.62） than the control group（158.05±16.71），（32.32±4.74）（P＜0.05）. The total incidence of postoperative pulmonary complications in the observation group （31.43%） was lower than that in the control group （78.38%）（P＜0.05）. Additionally，fewer patients in the observation group required postoperative sputum suction 7 cases （20.00%） compared to the control group 16 cases （43.24%）（P ＜0.05）. There were no deaths one month after the operation.
Conclusion
The combination of a multimodal respiratory training device and comprehensive PRT management improves perioperative lung function，reduces the incidence of pulmonary complications，and enhances quality of life in lung cancer patients undergoing thoracoscopic surgery. This approach is an effective perioperative management strategy with significant clinical implications.
To analyze the clinical application of dedicated medical thoracoscopy sheets in patients undergoing medical thoracoscopy for unexplained pleural effusion.
Methods
A total of 96 patients with unexplained pleural effusion who underwent medical thoracoscopy at our hospital from May 2023 to August 2024 were selected and randomly divided into an observation group 46 cases and a control group 50 cases. The observation group used dedicated medical thoracoscopy sheets，while the control group used standard medical examination pads. The one-time success rate of position placement，time required for position placement，patient satisfaction，and pleural fluid contamination of the surrounding environment were compared between the two groups.
Results
The observation group showed superior outcomes： one-time success of position placement was 41 cases （89.13%），time for position placement was（ 42.24±14.22 ）seconds，and patient satisfaction score was （90.93±8.00）. In contrast，the control group had a one-time success of 23 cases （46.00%），time for position placement of （61.50±18.20） seconds，and patient satisfaction score of （74.26±13.30）. Regarding environmental contamination，the observation group had 41 cases （89.13%） with a contamination score of 0，4 cases （8.70%） with a score of 1，and 1 case （2.17%） with a score of 2. The control group had 3 cases（6.00%） with a score of 0，12 cases （24.00%） with a score of 1，18 cases （36.00%） with a score of 2，12 cases （24.00%） with a score of 3，and 5 cases （10.00%） with a score of 4 （P＜0.001）.
Conclusion
The dedicated medical thoracoscopy sheet improves the efficiency of patient positioning，shortens preoperative preparation time，reduces the risk of pleural fluid contamination，and enhances patient satisfaction，demonstrating significant clinical value.
To analyze the risk factors of secondary pulmonary fungal infection in patients with diabetes mellitus （DM） and pulmonary tuberculosis.
Methods
A total of 73 DM patients with pulmonary tuberculosis admitted to our hospital from January 2017 to December 2024 were selected as the subjects，and 27 patients with secondary pulmonary fungal infection were divided into the observation group and 46 patients without infection as the control group. The clinical data of the two groups were compared，and the risk factors of secondary pulmonary fungal infection in DM patients with pulmonary tuberculosis were analyzed by Logistic regression. Draw a nomogram. The predictive value was analyzed by receiver operating curve （ROC）.
Results
In the observation group，there were 15 cases （55.56%） of Candida albicans infection，7 cases （25.93%） of Candida tropicalis，4 cases （14.81%） of Candida parapsilosis，and 1 case （3.70%） of Candida krusei. In the observation group，19 cases （70.37%） survived，8 cases （29.63%） died，including 4 cases （14.81%） of respiratory failure，2 cases （7.41%） of multiple organ dysfunction and 2 cases （7.41%） of septic shock. The observation group was （40.09±12.33） years old，13 patients （48.15%） had a history of smoking，fasting blood glucose （13.09±2.89） mmol/L，2 h postprandial blood glucose （15.88±4.17） mmol/L，broad-spectrum antibiotics （2.31±0.49） weeks，glucocorticoids （2.82±0. 58） week compared with the control group （47.63±12.16） years old，33 cases （52.17%） had a smoking history，fasting blood glucose （10.37±2.48） mmol/L，2 h postprandial blood glucose （11.99±3.36） mmol/L，broad-spectrum antibiotics （1.86±0.41） weeks，glucocorticoid drug use （2）. The difference was statistically significant at 21±0.51 weeks （P＜0.05）. Excluding confounding factors，Logistic regression analysis showed that fasting blood glucose （OR= 1.952，95%CI：1.019～3.741），2 h postpranpranal blood glucose （OR=2.287，95%CI： 1.046 ～4.999），broad-spectrum antibiotics （OR=358.104，95%CI：2.482 ～51 661.842） and glucocorticoid use （OR=221.420，95%CI：1.651～29 691.790） were risk factors for secondary pulmonary fungal infection. ROC curve showed that the area under curve （AUC） of fasting blood glucose，2 h postprandial blood glucose，broad-spectrum antibiotics and glucocorticoids combined to predict secondary pulmonary fungal infection in DM patients with pulmonary tuberculosis was 0.964. It was higher than that of single detection （Z=4.470，2.864，3.090，2.946，P＜0.05）.
Conclusion
The incidence of secondary pulmonary fungal infection in DM patients with pulmonary tuberculosis is high. Fasting blood glucose，2 h postprandial blood glucose，broad-spectrum antibiotics and glucocorticoid drug are risk factors for secondary pulmonary fungal infection.
To analyze the status and influencing factors of cancer-related fatigue in patients with end-stage lung cancer.
Methods
All of 75 patients with end-stage lung cancer admitted to our hospital from August 2021 to August 2023 were selected as subjects. According to the revised Piper fatigue scale（RPFS），32 cases with cancer-related fatigue were divided into observation group and 43 cases without cancerrelated fatigue were divided into control group. The RPFS score was analyzed，the clinical data of the two groups were compared，and the influencing factors of cancer-related fatigue in end-stage lung cancer patients were analyzed by Logistic regression，and a nomogram model was established.
Results
The scores of physical，behavioral，cognitive and emotional fatigue in the observation group were （5.09±1.17），（5.17±1.01），（4.08±0.89） and （4.12±0.95），respectively. The average total score was （4.58±1.12）. The visual analog scale（VAS） score of the observation group （3.50±0.70） was higher than that of the control group （2.65±0.68）（P＜0.05），and the Karnofsky （KPS）score （75.06±5.48） and SSRS （26.09±3.06） of the observation group were lower than those of control group KPS（82.31±6.45） and SSRS （29.97±3.31） （P＜0.05）. Logistic results showed that VAS score （OR=25.507，95%CI： 5.523～117.802） was a risk factor for cancer-related fatigue，KPS score （OR=0.725，95%CI： 0.585 ～0.900），SSRS score （OR=0.679，95%CI： 0.492 ～0.936） was a protective factor for cancer-related fatigue （P＜0.05）. 75 cases by 7∶3 split the training set and the verification set，the training set of 52 cases，the verification set of 23 cases，the training set and the verification set predicted the receiver operating characteristic （ROC） curve （area under curve，AUC） （95%CI） were 0.98（0.96～1.00） and 0.93 （0.80～1.00），respectively. Calibration curve results showed that the calibration curve predicted by the nomogram model was close to the ideal curve （P=0.907，0.871）. The decision curve analysis（DCA） shows that the probability threshold of the nomogram model was 20%～90% and the net return was higher.
Conclusion
The incidence of cancer-related fatigue is high in patients with end-stage lung cancer.VAS score，KPS score and SSRS score are influential factors of cancer-related fatigue in end-stage lung cancer.Targeted intervention can reduce the incidence of fatigue.
To analyze the efficacy and safety of bronchoscopic holmium laser in the treatment of central airway obstruction （CAO） while investigating its distinctive role in obstruction caused by various diseases，thus providing valuable insights for clinicians when applying this technique.
Methods
All of 7 patients with central airway obstruction caused by various etiologies selected from Zhuzhou Second Hospital between December 2017 and August 2023. These patients were all treated with bronchoscopic holmium laser therapy，and it was analyzed these cases carefully to evaluate the safety and efficacy of this treatment method in central airway obstruction.
Results
The patients consisted of 2 females and 5 males，Age 57 ～69 years old，with an average age of （65.43±6.32）years. Based on etiology，benign central airway obstruction was observed in 4 patients，while malignant central airway obstruction was present in 3 patients. Obstruction lesions involved the trachea 2 cases as well as the main or intermediate bronchus 5 cases. The primary etiologies encompassed a diverse range including hamartoma 1 case，post-tracheotomy stenosis 1 case，bronchial foreign body 1 case，bronchial calculus 1 case，and central airway obstruction due to lung cancer 3 cases. The patient was treated with holmium laser under bronchoscopy. There was a small amount of bleeding during the treatment，and no complications such as pneumothorax or infection occurred. After treatment，the symptoms such as chest tightness，shortness of breath，cough and expectoration were alleviated or disappeared.
Conclusion
Bronchoscopic holmium laser therapy has several advantages in the treatment of central airway obstruction such as rapid removal of lesions and clear surgical field，in particular，it plays an irreplaceable role in ablating bony foreign bodies and destroying dislocated stent，and it is safe in the treatment process. Notably，this technology is suitable for treating both benign and malignant lesions，holding significant value as a therapy option.
To observe the effects of regular and irregular medication on the frequency of acute exacerbations，total treatment costs，dyspnea index （mMRC），COPD assessment test scores （CAT），and forced expiratory volume in the first second （ FEV1） over a 12-month period for patients with COPD in remission.
Methods
A total of 117 patients diagnosed with COPD in remission at our hospital from September 2019 to September 2023 were select. Patients were divided into a control group of 52 who used medications irregularly and an observation group of 65 who used medications regularly. The observation group received longterm regular inhaled corticosteroids （ICS） combined with long-acting β2 receptor agonists （LABA），such as salmeterol fluticasone powder inhaler （Sulair），budesonide formoterol powder inhaler （Xinafo），or long-acting anticholinergic drugs （long-acting muscarine anticholinergic，LAMA），such as tiotropium bromide，or triple formulations，such as fluticasone propionate and budesonide. Observe the number of acute exacerbations，total economic costs，mMRC and CAT scores，and FEV1 in both groups at 12 months post-treatment.
Results
During the medication period，the observation group experienced 1 exacerbation （mainly coughing and sputum production，relieved after outpatient treatment） in 32 cases，2 in 2 cases，and 1 in 1 case； the control group experienced 2 exacerbations （mainly coughing and sputum production，relieved after outpatient treatment； some with significant dyspnea and shortness of breath，relieved after hospitalization） in 27 cases，3 in 23 cases，and 4 in 2 cases. After 12 months of treatment，the FEV1 value （1.11±0.31） L，mMRC score （1.85±0.89） points，and CAT score （14.23±5.12） points in the observation group were lower than those in the control group （0.74±0.15） L，（2.81±0.73） points，and （25.86±2.84） points （P＜0.05）； the total medical expenses in the observation group （7 096.25±2 731.87） yuan were lower than those in the control group （9 780.00± 3 093.74）yuan （P＜0.05）.
Conclusion
For COPD patients in remission who follow medical advice and receive longterm regular inhalation therapy，improve lung function，enhance quality of life，reduce hospitalization frequency，and lower economic costs.
